90
|
GenScript corporation
rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3 Rt Primer 5’ Tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn 3, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3/product/GenScript corporation Average 90 stars, based on 1 article reviews
rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Kaneka Corp
btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3 Btv6 S2 Serotype Specific Rt Pcr Forward Primer 5’ Aggaacagtcggcttatcac 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3/product/Kaneka Corp Average 90 stars, based on 1 article reviews
btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
rt primer 5’-gccttggcacccgagaattcca-3 Rt Primer 5’ Gccttggcacccgagaattcca 3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt primer 5’-gccttggcacccgagaattcca-3/product/Illumina Inc Average 90 stars, based on 1 article reviews
rt primer 5’-gccttggcacccgagaattcca-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′) 1 Pmol Of Rt Down Primer (5′ Ggtgtcgccgagcagcggggtggt 3′), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′)/product/Promega Average 90 stars, based on 1 article reviews
1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3 Rt Primer 5’ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3/product/Illumina Inc Average 90 stars, based on 1 article reviews
rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Kaneka Corp
btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3 Btv8 S2 Serotype Specific Rt Pcr Forward Primer 5’ Cggagacagcgcagtatgta 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3/product/Kaneka Corp Average 90 stars, based on 1 article reviews
btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
rt primer: 5´-gccttggcacccgagaattccagttt-3´ Rt Primer: 5´ Gccttggcacccgagaattccagttt 3´, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt primer: 5´-gccttggcacccgagaattccagttt-3´/product/Metabion International AG Average 90 stars, based on 1 article reviews
rt primer: 5´-gccttggcacccgagaattccagttt-3´ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer 25 Pmol Rt Primer (5’ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3’) For Tru Seq Barcodes (Rp1 Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer/product/Illumina Inc Average 90 stars, based on 1 article reviews
25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes Rt Primer 5′ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3′ Tru Seq Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes/product/Illumina Inc Average 90 stars, based on 1 article reviews
rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Oligos Etc
rt-primer 5»- gga agc cag gaa aga cag-3» Rt Primer 5» Gga Agc Cag Gaa Aga Cag 3», supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt-primer 5»- gga agc cag gaa aga cag-3»/product/Oligos Etc Average 90 stars, based on 1 article reviews
rt-primer 5»- gga agc cag gaa aga cag-3» - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
TAG Copenhagen A/S
rt-primer (5′-caggtccagtttttttttttttttvn Rt Primer (5′ Caggtccagtttttttttttttttvn, supplied by TAG Copenhagen A/S, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt-primer (5′-caggtccagtttttttttttttttvn/product/TAG Copenhagen A/S Average 90 stars, based on 1 article reviews
rt-primer (5′-caggtccagtttttttttttttttvn - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
TwistDx Inc
rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′) Rt Rpa Lfr Forward Primer (5′ Gtatagcagcatactctttccctttcttcacc 3′), supplied by TwistDx Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′)/product/TwistDx Inc Average 90 stars, based on 1 article reviews
rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |