rt primer 5 Search Results


90
GenScript corporation rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3
Rt Primer 5’ Tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn 3, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rt primer 5’-tacgagatgtgactggagttcagacgtgtgctcttccgatctnnnnnnnnttttttttttttttttttvn-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Kaneka Corp btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3
Btv6 S2 Serotype Specific Rt Pcr Forward Primer 5’ Aggaacagtcggcttatcac 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3/product/Kaneka Corp
Average 90 stars, based on 1 article reviews
btv6-s2 serotype-specific rt-pcr forward primer 5’-aggaacagtcggcttatcac-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc rt primer 5’-gccttggcacccgagaattcca-3
Rt Primer 5’ Gccttggcacccgagaattcca 3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt primer 5’-gccttggcacccgagaattcca-3/product/Illumina Inc
Average 90 stars, based on 1 article reviews
rt primer 5’-gccttggcacccgagaattcca-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega 1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′)
1 Pmol Of Rt Down Primer (5′ Ggtgtcgccgagcagcggggtggt 3′), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′)/product/Promega
Average 90 stars, based on 1 article reviews
1 pmol of rt-down primer (5′-ggtgtcgccgagcagcggggtggt-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3
Rt Primer 5’ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3/product/Illumina Inc
Average 90 stars, based on 1 article reviews
rt primer 5’-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Kaneka Corp btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3
Btv8 S2 Serotype Specific Rt Pcr Forward Primer 5’ Cggagacagcgcagtatgta 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3/product/Kaneka Corp
Average 90 stars, based on 1 article reviews
btv8-s2 serotype-specific rt-pcr forward primer 5’-cggagacagcgcagtatgta-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG rt primer: 5´-gccttggcacccgagaattccagttt-3´
Rt Primer: 5´ Gccttggcacccgagaattccagttt 3´, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt primer: 5´-gccttggcacccgagaattccagttt-3´/product/Metabion International AG
Average 90 stars, based on 1 article reviews
rt primer: 5´-gccttggcacccgagaattccagttt-3´ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc 25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer
25 Pmol Rt Primer (5’ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3’) For Tru Seq Barcodes (Rp1 Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer/product/Illumina Inc
Average 90 stars, based on 1 article reviews
25 pmol rt primer (5’- aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3’) for tru-seq barcodes (rp1 primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes
Rt Primer 5′ Aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga 3′ Tru Seq Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes/product/Illumina Inc
Average 90 stars, based on 1 article reviews
rt primer 5′-aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga-3′ tru-seq barcodes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Oligos Etc rt-primer 5»- gga agc cag gaa aga cag-3»
Rt Primer 5» Gga Agc Cag Gaa Aga Cag 3», supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt-primer 5»- gga agc cag gaa aga cag-3»/product/Oligos Etc
Average 90 stars, based on 1 article reviews
rt-primer 5»- gga agc cag gaa aga cag-3» - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
TAG Copenhagen A/S rt-primer (5′-caggtccagtttttttttttttttvn
Rt Primer (5′ Caggtccagtttttttttttttttvn, supplied by TAG Copenhagen A/S, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt-primer (5′-caggtccagtttttttttttttttvn/product/TAG Copenhagen A/S
Average 90 stars, based on 1 article reviews
rt-primer (5′-caggtccagtttttttttttttttvn - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
TwistDx Inc rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′)
Rt Rpa Lfr Forward Primer (5′ Gtatagcagcatactctttccctttcttcacc 3′), supplied by TwistDx Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′)/product/TwistDx Inc
Average 90 stars, based on 1 article reviews
rt-rpa-lfr forward primer (5′-gtatagcagcatactctttccctttcttcacc-3′) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results